Journal of Clinical Microbiology, January 1998, p. 115-117, Vol. 36, No. 1
0095-1137/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Virulence Factors of Escherichia coli
Isolates From Patients with Symptomatic and Asymptomatic Bacteriuria
and Neuropathic Bladders Due to Spinal Cord and Brain
Injuries
Richard A.
Hull,1,*
Delbert C.
Rudy,2
Inge E.
Wieser,2 and
William
H.
Donovan3,4
Department of Microbiology and Immunology,
Baylor College of Medicine,1
Division of
Urology,2 and
Department of Physical
Medicine and Rehabilitation,3 University of
Texas Health Science Center, and
The Institute for Rehabilitation
and Research,4 Houston, Texas
Received 13 June 1997/Returned for modification 11 August
1997/Accepted 8 October 1997
 |
ABSTRACT |
Chronic bacteriuria is a common occurrence among spinal-cord injury
patients and others with neuropathic bladders. If bacteria are present
in the urinary tract, the patient may develop symptoms of infection or
remain asymptomatic. We have compared virulence properties of 28 Escherichia coli isolates from patients with symptomatic
urinary tract infections (UTI) and 29 E. coli isolates from
patients with asymptomatic bacteriuria (ABU). Bacteria from patients
with symptomatic UTI were more likely to be hemolytic than isolates
from patients with ABU (P = 0.05) or fecal isolates obtained from healthy volunteers (P < 0.001).
Bacteria from patients with symptomatic UTI were also more likely than
strains isolated from patients with ABU (P = 0.08) or
fecal strains (P < 0.001) to exhibit
D-mannose-resistant hemagglutination of human erythrocytes. The results suggest that E. coli isolates from
nonimmunocompromised patients who require intermittent catheterization
and who develop symptomatic UTI may be distinguished from bacteria
recovered from patients who remain asymptomatic and possibly from
normal fecal E. coli.
 |
INTRODUCTION |
Urinary tract infection (UTI) is a
frequent medical complication during the initial medical and
rehabilitation period after spinal-cord injury (SCI) and traumatic
brain injury (TBI) and continues to be a problem throughout the life of
many spinal-cord-injured individuals. The urine of patients with
neuropathic bladders frequently contains bacteria, and
Escherichia coli is among the most frequent bladder
colonizers (1, 5, 6). These bacteria may produce symptoms of
UTI or may produce only asymptomatic bacteriuria (ABU). Bacteria
associated with ABU are often left untreated and may even be beneficial
in preventing symptomatic infection by more virulent organisms
(16). Little is known at present about the virulence
properties of E. coli bacteria that cause symptomatic UTI in
patients with neuropathic bladders or how these strains may differ from
benign colonizing strains. In the present study, approved by the
Institutional Review Board of the hospital at which it was performed,
we investigated selected virulence properties of E. coli
isolates from SCI and TBI patients with UTI and ABU. Our hypothesis was
that E. coli isolates from patients with symptomatic UTI
possess virulence properties that may be used to distinguish them from
other E. coli strains.
 |
MATERIALS AND METHODS |
Patient characteristics.
Subjects were selected from
patients admitted to a rehabilitation hospital between January 1994 and
December 1996 with a diagnosis of SCI or TBI who were treated with
intermittent catheterization and acquired at least one colonization of
the urinary tract with E. coli. Twenty-five patients
developed 28 symptomatic UTIs due to E. coli during that
time. Of these 16 males and 9 females, 4 had TBI and 21 had SCI (12 tetraplegics and 9 paraplegics); the mean age was 39 (range, 7 to 75).
Twenty-seven patients were colonized 29 times with E. coli
but remained asymptomatic. Of these 15 males and 12 females, 1 had TBI
and 19 had SCI (9 tetraplegics and 10 paraplegics); the mean age was 42 (range, 14 to 70). Symptomatic UTI was defined as a fever of at least
38.5°C (101°F) plus one or more of the following symptoms in a
patient with a urine colony count of >100,000 CFU per ml: voiding
between catheterizations which had not previously occurred, otherwise
unexplained increase in spasticity, pyuria (>10 leukocytes per
high-power field), or hematuria. Such UTIs were treated with an
antibiotic chosen from the antibiogram report indicating sensitivities
to antibiotics. All patients had documented sterile urine after
discontinuation of the antibiotics.
Collection of specimens.
All patients while on intermittent
catheterization had a catheterized urine specimen collected under
sterile conditions once weekly. Isolates from patients with symptomatic
UTI used in this study were collected prior to initiation of
antimicrobial therapy. These specimens were kept on ice and transported
to the clinical microbiology laboratory within 20 min. Samples were
streaked for single colonies on MacConkey agar, sheep blood agar, and
Columbia CNA agar plates (BBL, Cockeysville, Md.). E. coli
isolates were identified by standard microbiological methods. All
E. coli isolates identified from colonizations where
E. coli was the only species, or the predominant species
(>99%), present were subjected to further analysis as described
below. In five instances, isolates from the same patient were collected
from separate infection or colonization events. Such isolates were
verified as unique based on differences in antibiogram biotype and/or
pulsed-field gel electrophoretic analysis of endonuclease-digested
whole-cell DNA. The charts of the patients from whose specimens the
E. coli isolates grew were also reviewed based on the
criteria listed above to determine whether or not each patient had a
UTI and was in fact treated. If the patient's manifestations met the
criteria and the patient was treated, the colonization was counted as
symptomatic.
Determination of phenotypes.
Methods used for assay of
hemolysin expression, serum resistance, and
D-mannose-resistant hemagglutination (MRHA) of human erythrocytes have been described previously and were used without modification (9, 12). Strains were identified as
prototrophic or auxotrophic by testing for capacity to grow on minimal
salts agar supplemented with 0.4% glucose (4).
Colony blot hybridization.
Colony DNA blots were prepared
from a single colony of each isolate by the steam-alkaline lysis method
of Maas (14). Hybridization probes were purified as
restriction endonuclease fragments from recombinant plasmids or
synthesized as PCR amplification products from plasmid-containing
strains. Specific hybridization probes used for detection of
dra, pap, hly, and pil
genes have been described elsewhere (2, 9, 17). Probes
specific for focH and sfaS were prepared by PCR
amplification of recombinant-DNA strains HB101(pPIL110-54) and
HB101(pANN801-13), respectively, kindly provided by J. Hacker. The
sequences of PCR primers used were 5' GACGTGGATACGACGATTACTG 3'
and 5' TACGCATAGGTATAGGTGAC 3'. The probe for
ucaA was prepared by PCR amplification of Proteus
mirabilis HU1069 (3). Primer sequences were 5'
CTCATAAGCGATGGTGTAATGAACTGTAGC 3' and 5'
TATGACGGTACAATTACTTTTACTGGAAA 3'. Probes were radiolabeled with a
random priming kit (Pharmacia). Hybridizations were conducted at high
stringency (in 1× SSC [0.15 M NaCl plus 0.015 M sodium citrate] at
68°C).
Antimicrobial resistance.
The disk diffusion method was used
to determine antimicrobial susceptibility. Antimicrobials tested
included amikacin, ampicillin, ampicillin-sublactam, augmentin,
cefazolin, ceftazidime, ceftriaxone, cefuroxime, cephalothin,
ciprofloxacin, gentamicin, nitrofurantoin, norfloxacin, piperacillin,
tetracycline, tobramycin and trimethoprim-sulfamethoxazole.
Statistical methods.
Statistical comparisons were made by
chi-square analysis.
 |
RESULTS |
Single urinary tract (UT) E. coli isolates from
patients experiencing symptomatic UTI or ABU were examined for
expression of selected virulence phenotypes and for the presence of
virulence-associated genes. The results are summarized in Tables
1 and 2,
respectively.
View this table:
[in this window]
[in a new window]
|
TABLE 1.
Frequency of virulence-associated phenotypes among
E. coli isolates from patients with symptomatic UTI and ABU
|
|
Hemagglutination.
Isolates were tested for MRHA, the ability
to agglutinate human erythrocytes in the presence of the receptor
analog D-mannose. The MRHA+ phenotype was more
frequent among symptomatic-UTI isolates than among ABU isolates. The
frequencies of P pilus genes among symptomatic-UTI isolates and ABU
strains were similar. Two E. coli isolates from patients
with ABU possessed pap genes but did not express MRHA. One
ABU isolate was MRHA+ and possessed dra, but not
pap, genes. Symptomatic-UTI and ABU isolates were also
tested for the presence of other UT-associated adherence genes,
including genes for type 1 (pil), S (sfa), Dr (dra), type 1C (foc), and Uca (uca)
pili. For all except pil, the probes detected homologous
sequences at low frequency. One or more of the adherence genes were
present in 48% of symptomatic-UTI isolates and 36% of ABU isolates.
As reported in numerous other studies, type 1 pilus genes
(pil) were found in nearly all isolates; due to the nearly
ubiquitous nature of type 1 pili and the pil+
genotype among the Enterobacteriaceae, no further analysis
was pursued (2).
Hemolysin.
The Hly+ phenotype was significantly
more prevalent among E. coli isolates from patients with
symptomatic UTI than among ABU strains. Isolates were also probed for
hemolysin-specific DNA sequences. The frequency of hly genes
among symptomatic-UTI strains was greater than that among ABU isolates,
but the difference was not significant. Three Hly
hly+ isolates and one that was Hly+
but lacked hly were observed among E. coli
isolates from patients with ABU.
Serum resistance.
No significant difference was observed in
frequency of resistance to human serum between symptomatic-UTI and ABU
E. coli isolates. Values were similar to the reported
frequency of 52% for normal fecal strains.
Antimicrobial resistance.
No significant difference was
observed in frequency of resistance to one or more antimicrobial agents
between E. coli isolates from patients with symptomatic UTI
and ABU strains. The number of antimicrobial agents (of 17 tested) to
which these 49 isolates were resistant ranged from 1 to 9, with a mean
of 4.3.
Auxotrophy.
No significant difference was observed in
frequency of requirement for nutritional supplements for growth between
symptomatic-UTI and ABU isolates. Values are similar to reported values
for frequency of auxotrophy among normal fecal E. coli
isolates (35%) and isolates from non-SCI subjects with symptomatic UTI
(58%).
Associations.
The combined strain set (symptomatic UTI plus
ABU), which represents E. coli isolates that colonize the
neuropathic bladder, was analyzed for associations between virulence
factors. This analysis revealed that pap+
isolates were more frequently hly+ and expressed
the hemolytic phenotype (hly was present in 13 of 16 pap+ isolates but only in 1 of 35 isolates
lacking pap) (P < 0.005). A trend toward
increased antimicrobial resistance among pap+
strains was also noted (8 of 16 pap+ strains
versus 8 of 33 strains lacking pap were resistant)
(P < 0.1). In addition, a strong association was
observed between the auxotrophic phenotype and sensitivity to
antimicrobial agents (16 of 18 auxotrophic isolates versus 15 of 29 prototrophic isolates were sensitive) (P < 0.01).
 |
DISCUSSION |
Hemolysin is a cytolytic enzyme secreted by many E. coli isolates from patients with extraintestinal infections. Our
results suggest that hemolysin may contribute to clinical symptoms of UTI in SCI patients. This conclusion is consistent with results of an
earlier study of UT colonization in young women without SCI wherein the
hemolytic phenotype was found at significantly increased frequency
among symptomatic-UTI versus ABU isolates (8).
Bacterial adherence is widely held to contribute to colonization of the
normal UT. Our results suggest that D-mannose-resistant adherence and the pap+ genotype also were
associated with colonization of the UT in our patient group. The
present results are in contrast with a previous study of
catheter-associated E. coli bacteriuria in geriatric subjects wherein no correlation was found between MRHA or
pap genotype and UT colonization (15). However,
these studies may not be directly comparable because subjects in the
previous study had indwelling urinary catheters in place at least 30 days prior to the study, while the subjects in the present study were
managed with intermittent catheterization. The frequency of the
MRHA+ phenotype was also significantly greater among
isolates from patients with symptomatic infection in our study group
compared with the reported frequency of MRHA+ E. coli in bowel flora of the general population (16%)
(P < 0.001) (7, 10). One interpretation may
be that D-mannose-resistant adherence contributes to
E. coli urovirulence in this patient group. Alternately, the
increased presence of MRHA+ bacteria among symptomatic-UTI
isolates may reflect their possibly increased presence in the bowel
flora of our study group. However, numerous studies have shown a low
frequency of MRHA among fecal isolates from a variety of subject
populations. Additional studies comparing the frequency of virulence
factors among fecal isolates of SCI patients with those for other
subject groups will be required to address this possibility.
Consistent with numerous published reports showing that E. coli type 1 pili contribute to bladder colonization,
pil genes were detected in a majority of both
symptomatic-UTI and ABU E. coli isolates in this study.
Other UT-associated adherence genes representing S, type 1C, and Dr
pili were found at reduced frequency in all SCI isolates, as has been
reported for E. coli isolates from the UTs of non-SCI
patients (10). E. coli strains were tested for
the presence of uca genes, previously described only in
P. mirabilis, because of reported similarities between the Uca structural protein and a protein associated with the E. coli G hemagglutinin (3). uca genes were
found at low frequency among urine isolates from SCI and TBI subjects.
Additional studies will be required to determine whether uca
genes in E. coli promote uroepithelial cell adherence as
they do in P. mirabilis.
The frequencies of other tested properties, including serum resistance,
antimicrobial resistance, and auxotrophy, among symptomatic-UTI and ABU
E. coli isolates were not significantly different. However, associations were found between these properties and other
virulence-associated traits. We observed, as have others, a close
correlation between pap and hly, most likely the
result of these traits being linked genetically on the E. coli chromosome (9, 11). We also found a significant
association between auxotrophy and sensitivity to antimicrobial agents
commonly used for treatment of UTI. This finding suggests possible
selection of auxotrophy among sensitive clinical isolates. The
mechanism for selection is currently unclear. Our results did not
confirm an increased frequency of auxotrophic bacteria among UT
isolates compared with normal fecal E. coli isolates as
reported in studies of non-SCI subjects (13).
In conclusion, we have determined that E. coli isolated from
patients with symptomatic UTI undergoing intermittent catheterization may be distinguished from ABU isolates and normal fecal bacteria on the
basis of their virulence characteristics. Our results point to the need
for further research to determine if virulence factors such as
hemolysin can guide the clinician in deciding whether or not to treat
for E. coli colonization by indicating which isolates pose a
higher risk of causing a symptomatic UTI under certain conditions. The
results also suggest that future vaccines directed against selected
bacterial virulence antigens may be of value in reducing the frequency
of symptomatic UTI in this high-risk patient group.
 |
ACKNOWLEDGMENTS |
This work was supported by Public Health Service grant HD30535
and by a grant from the Paralyzed Veterans of America Spinal Cord
Research Foundation.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Microbiology and Immunology, Baylor College of Medicine, 1 Baylor
Plaza, Houston, TX 77030. Phone: (713) 798-4946. Fax: (713) 798-7375. E-mail: rhull{at}bcm.tmc.edu.
 |
REFERENCES |
| 1.
|
Bennett, C. J.,
M. N. Young, and H. Darrington.
1995.
Differences in urinary tract infections in male and female spinal cord injury patients on intermittent catheterization.
Paraplegia
33:69-72[Medline].
|
| 2.
|
Buchanan, K.,
S. Falkow,
R. A. Hull, and S. I. Hull.
1985.
Frequency among Enterobacteriaceae of the DNA sequences encoding type 1 pili.
J. Bacteriol.
162:799-803[Abstract/Free Full Text].
|
| 3.
|
Cook, S. W.,
N. Mody,
J. Valle, and R. Hull.
1995.
Molecular cloning of Proteus mirabilis uroepithelial cell adherence (uca) genes.
Infect. Immun.
63:2082-2086[Abstract].
|
| 4.
|
Davis, B. D., and E. S. Mingioli.
1950.
Mutants of Escherichia coli requiring methionine or vitamin B12.
J. Bacteriol.
60:17-28[Free Full Text].
|
| 5.
|
Donovan, W. H.,
R. Hull, and C. D. Rossi.
1996.
Analysis of Gram negative colonization of the neuropathic bladder among patients with spinal cord injuries.
Spinal Cord
34:587-591.
|
| 6.
|
Donovan, W. H.,
W. C. Stolov,
D. E. Clowers, and M. R. Clowers.
1978.
Bacteriuria during intermittent catheterization following spinal cord injury.
Arch. Phys. Med. Rehabil.
59:351-357[Medline].
|
| 7.
|
Hagberg, L.,
U. Jodal,
T. K. Korhonen,
G. Lidin-Janson,
U. Lindberg, and C. Svanborg-Edén.
1981.
Adhesion, hemagglutination, and virulence of Escherichia coli causing urinary tract infections.
Infect. Immun.
31:564-570[Abstract/Free Full Text].
|
| 8.
|
Hull, R. A.,
S. I. Hull,
B. H. Minshew, and S. Falkow.
1980.
Genetics of hemolysin of Escherichia coli, p. 1283-1285.
In
J. D. Nelson, and C. Grassi (ed.), Current chemotherapy and infectious disease. Proceedings of the 11th International Congress of Chemotherapy and the 19th Interscience Conference on Antimicrobial Agents and Chemotherapy, vol. II. American Society for Microbiology, Washington, D.C.
|
| 9.
|
Hull, S. I., and R. A. Hull.
1986.
Linkage and duplication of copies of genes encoding P fimbriae and hemolysin in the chromosome of a uropathogenic Escherichia coli isolate, p. 157-163.
In
E. H. Kass, and C. Svanborg-Eden (ed.), Host-parasite interactions in urinary tract infections. University of Chicago Press, Chicago, Ill.
|
| 10.
|
Johnson, J.
1991.
Virulence factors in Escherichia coli urinary tract infection.
Clin. Microbiol. Rev.
4:80-128[Abstract/Free Full Text].
|
| 11.
|
Johnson, J. R.,
S. L. Moseley,
P. L. Roberts, and W. E. Stamm.
1988.
Aerobactin and other virulence factor genes among strains of Escherichia coli causing urosepsis: association with patient characteristics.
Infect. Immun.
56:405-412[Abstract/Free Full Text].
|
| 12.
|
Kanukollu, U.,
S. Bieler,
S. Hull, and R. Hull.
1985.
Contribution of the traT gene to serum resistance among clinical isolates of Enterobacteriaceae.
J. Med. Microbiol.
19:61-67[Abstract].
|
| 13.
|
Kunin, C. M.,
T. H. Hua,
C. Krishnan, and L. White.
1993.
Do temperature-sensitive auxotrophs of Escherichia coli have special virulence?
J. Clin. Microbiol.
31:47-49[Abstract/Free Full Text].
|
| 14.
|
Maas, R.
1983.
An improved colony hybridization method with significantly increased sensitivity for detection of single genes.
Plasmid
10:296-298[Medline].
|
| 15.
|
Mobley, H. L. T.,
G. R. Chippendale,
J. H. Tenney,
R. A. Hull, and J. W. Warren.
1987.
Expression of type 1 fimbriae may be required for persistence of Escherichia coli in the catheterized urinary tract.
J. Clin. Microbiol.
25:2253-2257[Abstract/Free Full Text].
|
| 16.
|
Montgomerie, J. Z.
1992.
Treatment of urinary tract infection in patients with spinal cord injury, p. 1-13.
In
Prevention and management of urinary tract infections among people with spinal cord injuries. Proceedings of the Consensus Validation Conference. National Institute on Disability and Rehabilitation Research, Washington, D.C.
|
| 17.
|
Nowicki, B.,
C. Svanborg-Edén,
R. Hull, and S. Hull.
1989.
Molecular analysis and epidemiology of the Dr hemagglutinin of uropathogenic Escherichia coli.
Infect. Immun.
57:446-451[Abstract/Free Full Text].
|
Journal of Clinical Microbiology, January 1998, p. 115-117, Vol. 36, No. 1
0095-1137/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.